cDNAalign
  26 Apr. 2016. Jun Inoue.

Alignment using mafft and trimAL (-gappyout)

Nuclear DNA Vertebrate mtDNA
Example:
>Human
ATGACTGACAATGAGCTGTCTGCCTTGGTAGTGGATAATGGGTCAGGGATGTGCAAGGC
AGGCTTTGGTGGTGACGATGCCCCCCGGGCT
>Zebrafish
ATGGATGAGGAAATCGCTGCCCTGGTCGTTGACAACGGCTCCGGTATGTGCAAAGCCGG
TTTTGCTGGAGATGATGCCCCTCGTGCTGTT
>Chicken
ATGGAAGAGGAGATCGCAGCGCTCGTGATCGACAATGGCTCCGGCATGTGCAAGGCGGG
ATTCGCCGGGGATGACGCTCCCCGCGCCGTG
>Lancelet
ATGTGCGACGACGAGGAAACGACTGCTCTGGTTGTTGACAATGGCTCCGGACTTGTGAA
GGCTGGCTTCGCCGGCGACGACGCCCCCAGG
>Seqsquirt
ATGTCTGAAGAAGAAGAAGAACAAACCGCACTCGTATGCGACAACGGATCCGGTCTTGT
GAAAGCTGGTTTCGCTGGAGATGACGCTCCA

TopPage jun-inoueAToist.jp Link